Sequence ID | >SRA1028364 |
Genome ID | SRR035086.309536 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001807) |
Species | |
Start position on genome | 91 |
End posion on genome | 174 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
attgtgacaT |
tRNA gene sequence |
GACAATGTGGCCGAGTGGTTAAGGCGTTGGACTGCTAATCCAATGGGCTCTGCCCGCGTG |
Downstream region at tRNA end position |
atttttattt |
Secondary structure (Cloverleaf model) | >SRA1028364 Ser GCT T GTaa atttttattt G - C A - T C - G A - T A - T T + G G - C T A T T A C C C A T G A G + | | | | G G G C C G G T G G G C G | | | T T T A G G C T A G TGGGCTCTGCCCGC T - A T - A G - C G - C A - T C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |