Sequence ID | >SRA1028632 |
Genome ID | SRR035086.378762 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001807) |
Species | |
Start position on genome | 63 |
End posion on genome | 136 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
tttgcgacat |
tRNA gene sequence |
GGTCGGGTGGCCGAGCGGCTAGGCAGAGCTCTGCAAAAGCTCGTACAGCGGTTCGAATCC |
Downstream region at tRNA end position |
aaaaccccaa |
Secondary structure (Cloverleaf model) | >SRA1028632 Cys GCA t TCAA aaaaccccaa G - C G - C T - A C - G G - C G - C G - C T A T T C G C C A G A G | | | | | G C G C C G A G C G G C G | | | T T G A G G C C T A GTAC G - C A - T G - C C - G T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |