Sequence ID | >SRA1028722 |
Genome ID | SRR035086.410009 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001807) |
Species | |
Start position on genome | 105 |
End posion on genome | 29 |
Amino Acid | Thr |
Anticodon | AGT |
Upstream region at tRNA start position |
tagcaacgaG |
tRNA gene sequence |
GGCGCCATGGCTTAAGTTGGTTAAAGCGCCTGTTTAGTAAACAGGAGATCCCGAGTTCGA |
Downstream region at tRNA end position |
gtaatgacaa |
Secondary structure (Cloverleaf model) | >SRA1028722 Thr AGT G TAgt gtaatgacaa G - C G - C C - G G + T C - G C - G A - T T A T G G C T C A T G A A G | | | | | G T T T C G C C G A G C G | | | | T T G A A G C T T A G AGATC C - G C - G T - A G - C T - A T A T A A G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |