Sequence ID | >SRA1028905 |
Genome ID | SRR035087.34839 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001808) |
Species | |
Start position on genome | 345 |
End posion on genome | 268 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
atataattac |
tRNA gene sequence |
GGATGTATAGCTCAGTTGGTCAGAGCGCTTGTCTGATAAATAAGAGGTTCGATGGTTCAA |
Downstream region at tRNA end position |
ttttaaaatt |
Secondary structure (Cloverleaf model) | >SRA1028905 Ile GAT c ACCA ttttaaaatt G - C G - C A - T T - A G - C T - A A - T T C T C T A C C A T G A A | | | | | A T C T C G G A T G G C G | | | | T T G G A G C T C A G AGGTTC C - G T - A T - A G + T T - A C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |