| Sequence ID | >SRA1029046 |
| Genome ID | SRR035087.64718 |
| Phylum/Class | 454 Sequencing (SRP001808) |
| Species | |
| Start position on genome | 152 |
| End posion on genome | 78 |
| Amino Acid | Leu |
| Anticodon | CAA |
| Upstream region at tRNA start position |
cgctatttgc |
| tRNA gene sequence |
GATCTCATAGCCCAATTGGCAGAGGCAACGGTTTCAAACACCGTTCAGTGTTGGTTCGAG |
| Downstream region at tRNA end position |
gcttggatag |
| Secondary structure (Cloverleaf model) | >SRA1029046 Leu CAA
c ACtt gcttggatag
G + T
A - T
T - A
C - G
T + G
C - G
A - T T G
T C G A C C A
T A A A | + | | | G
T C C C G G T T G G C
G | | | T T
G A G G C
C A G A TCAGT
A - T
C - G
G - C
G - C
T - A
T C
T A
C A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |