Sequence ID | >SRA1029450 |
Genome ID | SRR035087.128890 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001808) |
Species | |
Start position on genome | 52 |
End posion on genome | 130 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
ccgaccatac |
tRNA gene sequence |
CCGACAGTGGGCTAATCTGGTAAGCCGCCTCGTTCGGGACGAGGACATCATGGGAGTTCA |
Downstream region at tRNA end position |
tatgttagat |
Secondary structure (Cloverleaf model) | >SRA1029450 Pro CGG c ACCA tatgttagat C - G C - G G - C A - T C - G A - T G - C T T T C T C T C A T A A G | + | | | A C T C G G G G G A G C T | | | | T T G A G C C G T A G ACATCAT C - G C - G T - A C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |