Sequence ID | >SRA1029478 |
Genome ID | SRR035087.134415 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001808) |
Species | |
Start position on genome | 248 |
End posion on genome | 322 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
ttagatcaat |
tRNA gene sequence |
GGCCTAGTGGCGAAGTGGTAACGCGGCTGTCTGCAAAACAGCTATGCGTCGGTTCGAATC |
Downstream region at tRNA end position |
gatttatcta |
Secondary structure (Cloverleaf model) | >SRA1029478 Cys GCA t TCAA gatttatcta G - C G - C C - G C - G T - A A - T G - C T A T C A G C C A G A G | | | | | G T A G C G G T C G G C G | | | T T G A C G C T A G TATGC G - C C - G T - A G - C T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |