Sequence ID | >SRA1029495 |
Genome ID | SRR035087.136651 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001808) |
Species | |
Start position on genome | 239 |
End posion on genome | 163 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
ccaaatctaT |
tRNA gene sequence |
GCTCCTTTGGTGTAGTACGGCCAATCATGCTGGTTTCTCAGGCCGGTGACGGGGGTTCGA |
Downstream region at tRNA end position |
aattttgagc |
Secondary structure (Cloverleaf model) | >SRA1029495 Glu CTC T ATtt aattttgagc G - C C - G T - A C - G C - G T + G T - A T A T T C C C C A A T G A G + | | | | G C T G T G G G G G G C G | | + T T G T C A T C C A A G TGAC C - G T + G G - C G - C T + G T G T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |