| Sequence ID | >SRA1029525 |
| Genome ID | SRR035087.141081 |
| Phylum/Class | 454 Sequencing (SRP001808) |
| Species | |
| Start position on genome | 112 |
| End posion on genome | 39 |
| Amino Acid | Thr |
| Anticodon | CGT |
| Upstream region at tRNA start position |
tttgtttgtg |
| tRNA gene sequence |
GCCGAGATAGCTCAGTTGGTAGAGCGGGCGCTTCGTAAGCGCCAGGTCGTGGGTTCGAAT |
| Downstream region at tRNA end position |
ttatcttccg |
| Secondary structure (Cloverleaf model) | >SRA1029525 Thr CGT
g TCtt ttatcttccg
G - C
C - G
C - G
G - C
A - T
G - C
A - T T A
T C G C C C A
T G A A | + | | | G
T C T C G G T G G G C
G | | | | T T
G G A G C
T A G AGGTC
G - C
G - C
C - G
G - C
C - G
T A
T A
C G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |