Sequence ID | >SRA1029585 |
Genome ID | SRR035087.149145 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001808) |
Species | |
Start position on genome | 77 |
End posion on genome | 2 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
aaccaactat |
tRNA gene sequence |
TCCGGCGTGGCTCAATTGGCAGAGCGGGTGGCTGTTAACCACTAGGTTGTAGGTTCGAGT |
Downstream region at tRNA end position |
annnnnnnnn |
Secondary structure (Cloverleaf model) | >SRA1029585 Asn GTT t GCAA annnnnnnnn T - A C - G C - G G - C G - C C - G G - C T G T C A T C C A T A A G | | | | | G T C T C G G T A G G C G | | | | T T G G A G C C A G AGGTT G + T G - C T - A G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |