Sequence ID | >SRA1029713 |
Genome ID | SRR035087.169386 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001808) |
Species | |
Start position on genome | 260 |
End posion on genome | 185 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
ccccgacttt |
tRNA gene sequence |
GCGGGAATAGCTCAGTTGGTAGAGCACTAGCCTTCCAAGCTAGTTGTCGCGGGTTCGAGA |
Downstream region at tRNA end position |
gtgtaatatc |
Secondary structure (Cloverleaf model) | >SRA1029713 Gly TCC t TCCA gtgtaatatc G - C C - G G - C G - C G - C A - T A - T A G T T G C C C A T G A A + | | | | G T C T C G G C G G G C G | | | | T T G G A G C T A A TTGTC C - G T - A A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |