Sequence ID | >SRA1029765 |
Genome ID | SRR035087.177920 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001808) |
Species | |
Start position on genome | 245 |
End posion on genome | 321 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gcccggtaat |
tRNA gene sequence |
GGTGAGGTAGCTCAGTTGGTTAGAGCACAGGATTCATAACCCTGAGGTCGAGGGTTCAAC |
Downstream region at tRNA end position |
gaagcgggtg |
Secondary structure (Cloverleaf model) | >SRA1029765 Met CAT t ACCA gaagcgggtg G - C G - C T - A G - C A - T G - C G + T T C T C T C C C A T G A A | | | | | A T C T C G G A G G G C G | | | | T T G G A G C T T A A AGGTC C - G A - T G - C G - C A C T A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |