Sequence ID | >SRA1029805 |
Genome ID | SRR035087.184384 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001808) |
Species | |
Start position on genome | 333 |
End posion on genome | 416 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
ctaatattat |
tRNA gene sequence |
ACGTCAGTAGCTTAACTGGTAAAGCAACGGTCTCCAAAACCGTGAGGAAACTCTATGAGG |
Downstream region at tRNA end position |
aattttttta |
Secondary structure (Cloverleaf model) | >SRA1029805 Trp CCA t GCCT aattttttta A - T C - G G - C T + G C - G A - T G - C T A T C T T C C A C A A A | | + | | G T T T C G G A G G G C G | | | | T T G A A G C T A A GAGGAAACTCTAT A - T C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |