Sequence ID | >SRA1029911 |
Genome ID | SRR035087.200014 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001808) |
Species | |
Start position on genome | 12 |
End posion on genome | 87 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
tatgcggtca |
tRNA gene sequence |
GCCGGTGTAGCTCAATTGGAAGAGCAAATCCGTTGTAACGATTAGGTTGGTGGTTCGATT |
Downstream region at tRNA end position |
gcccgtctat |
Secondary structure (Cloverleaf model) | >SRA1029911 Thr TGT a TCAA gcccgtctat G - C C - G C - G G + T G - C T - A G - C T T T T C A C C A T A A A + | | | | G T C T C G G G T G G C G | | | | T T G G A G C A A A AGGTT A - T A - T T - A C - G C C G A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |