Sequence ID | >SRA1029972 |
Genome ID | SRR035087.210287 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001808) |
Species | |
Start position on genome | 116 |
End posion on genome | 39 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
acaacttcat |
tRNA gene sequence |
GGGCCTGTAGCTCAGTTCGGTTAGAGCGCACGCCTGATAAGCGTGAGGTCGATGGTTCAA |
Downstream region at tRNA end position |
gctttgattg |
Secondary structure (Cloverleaf model) | >SRA1029972 Ile GAT t ACCA gctttgattg G - C G - C G - C C - G C - G T - A G - C T T T C T A C C A T T G A A | | | | | A C C T C G G A T G G C G | | | | T T G G A G C T T A G AGGTC C - G A - T C - G G - C C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |