| Sequence ID | >SRA1030045 |
| Genome ID | SRR035087.220648 |
| Phylum/Class | 454 Sequencing (SRP001808) |
| Species | |
| Start position on genome | 384 |
| End posion on genome | 458 |
| Amino Acid | Lys |
| Anticodon | CTT |
| Upstream region at tRNA start position |
gtcattgata |
| tRNA gene sequence |
GCCCCCATAACTCAATGGTAGAGTAGTTGCCTCTTAAGCAATTAGTTCTAGGTTCGAATC |
| Downstream region at tRNA end position |
attaaaataa |
| Secondary structure (Cloverleaf model) | >SRA1030045 Lys CTT
a ACCA attaaaataa
G - C
C - G
C - G
C - G
C - G
C - G
A - T T A
T G A T C C A
A A A | | | | | G
T C T C A C T A G G C
G | | | | T T
G G A G T
T A A TAGTT
G + T
T - A
T - A
G - C
C - G
C A
T A
C T T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |