| Sequence ID | >SRA1030111 |
| Genome ID | SRR035087.228796 |
| Phylum/Class | 454 Sequencing (SRP001808) |
| Species | |
| Start position on genome | 278 |
| End posion on genome | 204 |
| Amino Acid | Thr |
| Anticodon | CGT |
| Upstream region at tRNA start position |
gacccagctt |
| tRNA gene sequence |
GCCAGCGTAGCTCAGAGGTAGAGCAGCGGTTTCGTAAACCGCCGGTCAAGAGTTCGACTC |
| Downstream region at tRNA end position |
ctttttgaag |
| Secondary structure (Cloverleaf model) | >SRA1030111 Thr CGT
t TCCA ctttttgaag
G - C
C - G
C - G
A - T
G - C
C - G
G - C T C
T T T C T C A
G A A | | | | | G
A C T C G A A G A G C
G | | | | T T
G G A G C
T A A CGGTC
G - C
C - G
G - C
G - C
T - A
T A
T A
C G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |