Sequence ID | >SRA1030132 |
Genome ID | SRR035087.231596 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001808) |
Species | |
Start position on genome | 81 |
End posion on genome | 155 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
ttatttatga |
tRNA gene sequence |
TTTCGAGTGGTCTAACGGCAGGACGTCTGGCTTTGAACCAGGAGATTGTAGGTTCGATCC |
Downstream region at tRNA end position |
agagctgtta |
Secondary structure (Cloverleaf model) | >SRA1030132 Gln TTG a ACCA agagctgtta T - A T - A T - A C - G G - C A - T G - C C T T C A T C C A A A G | | | | | G C T C T G G T A G G C G + | | | T T G G G A C C A G AGATT T + G C - G T - A G - C G - C C A T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |