Sequence ID | >SRA1030145 |
Genome ID | SRR035087.233333 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001808) |
Species | |
Start position on genome | 432 |
End posion on genome | 361 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
attacgtttc |
tRNA gene sequence |
GGGCAGGTAGCTCAACGGTAGATCGCACCGCTGATAACGGTGTTGTTGGAGGTTCGATTC |
Downstream region at tRNA end position |
tcgaaacccc |
Secondary structure (Cloverleaf model) | >SRA1030145 Ile GAT c Attg tcgaaacccc G - C G - C G - C C - G A - T G - C G + T T T T T C T C C A A A A + | | | | G C C T C G G G A G G C G | | | T T G G A T C T A G TTGTT C - G A - T C - G C - G G - C C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |