Sequence ID | >SRA1030161 |
Genome ID | SRR035087.235141 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001808) |
Species | |
Start position on genome | 32 |
End posion on genome | 106 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
tgaactattt |
tRNA gene sequence |
TCCGGCGTAGCTCAGCGGTAGAGTAGGTGACTGTTAATCACTTGGTCGCTGGTTCGAATC |
Downstream region at tRNA end position |
ttatttcctc |
Secondary structure (Cloverleaf model) | >SRA1030161 Asn GTT t GCCA ttatttcctc T - A C - G C - G G - C G - C C - G G - C T A T C G A C C A G A A | | | | | G C C T C G G C T G G C G | | | + T T G G A G T T A A TGGTC G + T G - C T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |