Sequence ID | >SRA1030256 |
Genome ID | SRR035087.250714 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001808) |
Species | |
Start position on genome | 24 |
End posion on genome | 100 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
atgtataaga |
tRNA gene sequence |
CGCGGGGTGGAGCAGTCAGGTAGCTCGTTGGGCTCATAACCCAGAGGTCGTTGGTTCGAA |
Downstream region at tRNA end position |
aaacttggtt |
Secondary structure (Cloverleaf model) | >SRA1030256 Met CAT a ACCA aaacttggtt C A G - C C - G G - C G - C G - C G - C T A T C A A C C A T G A G | | | | | G C C G A G G T T G G C A | | | | T T G G C T C G T A G AGGTC T + G T - A G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |