Sequence ID | >SRA1030352 |
Genome ID | SRR035087.266316 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001808) |
Species | |
Start position on genome | 322 |
End posion on genome | 251 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ttctaactaa |
tRNA gene sequence |
CTGCTCGTGGTGCAAATGGTATCACATTCGGCTGTAGACCGAAAGTTTCGAGTTCGATTC |
Downstream region at tRNA end position |
ctctatatcc |
Secondary structure (Cloverleaf model) | >SRA1030352 Tyr GTA a Attt ctctatatcc C - G T - A G - C C - G T - A C - G G - C T T T G G C T C A A A A G + | | | | G T C G T G T C G A G C G | | | T T G T C A C T A A AGTT T - A T - A C - G G - C G - C C A T G G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |