Sequence ID | >SRA1030681 |
Genome ID | SRR035087.312926 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001808) |
Species | |
Start position on genome | 158 |
End posion on genome | 245 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
tggcgtctgc |
tRNA gene sequence |
GGAGGGGTCGCCTAGTGGTTTAGGGCACCCGTTTCGAAAGCGGGCAGGGGTAACACCCTC |
Downstream region at tRNA end position |
gtacgggggt |
Secondary structure (Cloverleaf model) | >SRA1030681 Ser CGA c GCCA gtacgggggt G - C G - C A - T G - C G + T G - C G - C T A T C G C C C A T G A C | | | | | G G T C C G G C G G G C G + | | | T T T G G G C T T A A CAGGGGTAACACCCTC C - G C - G C - G G - C T + G T A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |