Sequence ID | >SRA1030687 |
Genome ID | SRR035087.314750 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001808) |
Species | |
Start position on genome | 297 |
End posion on genome | 211 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
taattattaT |
tRNA gene sequence |
GCGTGAATGCCGGAGCGGTCAAACGGGGTGGGTTTAGAGCCCATTGCACATAGGTGCTAC |
Downstream region at tRNA end position |
atgcaaacaa |
Secondary structure (Cloverleaf model) | >SRA1030687 Leu TAG T ATta atgcaaacaa G - C C - G G - C T - A G + T A - T A - T T G T C G T C C A C G A G | | | | | G G G G C C G C A G G C G | | | T T T A C G G C A A G TGCACATAGGTGCTAC G + T T - A G - C G - C G - C T G T A T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |