| Sequence ID | >SRA1030740 |
| Genome ID | SRR035087.323321 |
| Phylum/Class | 454 Sequencing (SRP001808) |
| Species | |
| Start position on genome | 335 |
| End posion on genome | 261 |
| Amino Acid | Pro |
| Anticodon | TGG |
| Upstream region at tRNA start position |
aaagtacagt |
| tRNA gene sequence |
CTGGGTGTAGGCAAGTGGTATGCCGCCTGGTTTGGGACCAGGTGATCGTAGGTTCAAATC |
| Downstream region at tRNA end position |
tttttaattc |
| Secondary structure (Cloverleaf model) | >SRA1030740 Pro TGG
t ACCA tttttaattc
C - G
T - A
G - C
G + T
G - C
T - A
G - C T A
T C A T C C A
G A A | | | | | A
T A C G G G T A G G C
G | | | | T T
G T G C C
T A G TGATC
C - G
C - G
T - A
G - C
G - C
T A
T G
T G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |