Sequence ID | >SRA1030810 |
Genome ID | SRR035087.333474 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001808) |
Species | |
Start position on genome | 188 |
End posion on genome | 262 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
tcaactttcc |
tRNA gene sequence |
GGGCGAGTAACTCAGTTGGTTAGAGTGCATCCCTTACAAGGATGAAGTCGGGGGTTCGAG |
Downstream region at tRNA end position |
ccgcacccgc |
Secondary structure (Cloverleaf model) | >SRA1030810 Val TAC c ACac ccgcacccgc G - C G - C G - C C - G G - C A - T G + T T G T C T C C C A T G A A | + | | | G T C T C A G G G G G C G | | | | T T G G A G T T T A G AAGTC C - G A - T T - A C - G C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |