| Sequence ID | >SRA1031201 |
| Genome ID | SRR035087.390713 |
| Phylum/Class | 454 Sequencing (SRP001808) |
| Species | |
| Start position on genome | 175 |
| End posion on genome | 102 |
| Amino Acid | Leu |
| Anticodon | TAG |
| Upstream region at tRNA start position |
gtccgttttt |
| tRNA gene sequence |
GCCCCGGTAGGCCAAAGGCAGAGTCAGCGGATTTAGAATCCGTCAAGTCCTGGTTCAAAT |
| Downstream region at tRNA end position |
tatggggacg |
| Secondary structure (Cloverleaf model) | >SRA1031201 Leu TAG
t ACtt tatggggacg
G + T
C - G
C - G
C - G
C - G
G - C
G + T T A
T G G A C C A
A A A A | | | | | A
G C C G G C C T G G C
G | + | T T
C A G T C
A G A CAAGT
G + T
C - G
G - C
G - C
A - T
T A
T A
T A G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |