| Sequence ID | >SRA1031531 |
| Genome ID | SRR035087.445249 |
| Phylum/Class | 454 Sequencing (SRP001808) |
| Species | |
| Start position on genome | 407 |
| End posion on genome | 321 |
| Amino Acid | Leu |
| Anticodon | TAG |
| Upstream region at tRNA start position |
nnnnnnnnnt |
| tRNA gene sequence |
GCCCGAGTGGTGAAACTGGTATACACGCTAGTTTTAGGAACTAGTGAGGTAAAACTCGTG |
| Downstream region at tRNA end position |
atatcaaact |
| Secondary structure (Cloverleaf model) | >SRA1031531 Leu TAG
t ACCA atatcaaact
G - C
C - G
C - G
C - G
G - C
A - T
G - C T A
T C A G C C A
C A A G | | | | | G
T A G T G G T C G G C
G | | | T T
G A C A C
T A T G TGAGGTAAAACTCGT
C - G
T - A
A - T
G - C
T - A
T A
T G
T A G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |