| Sequence ID | >SRA1031732 |
| Genome ID | SRR035087.477918 |
| Phylum/Class | 454 Sequencing (SRP001808) |
| Species | |
| Start position on genome | 261 |
| End posion on genome | 350 |
| Amino Acid | Ser |
| Anticodon | GCT |
| Upstream region at tRNA start position |
taacacatac |
| tRNA gene sequence |
GGAGCGGTGCCTGAGAGGCCGAAAGGAACAGTTTGCTAAATTGTCGTACCTGAAAGGGTA |
| Downstream region at tRNA end position |
aaataatgcg |
| Secondary structure (Cloverleaf model) | >SRA1031732 Ser GCT
c GCCA aaataatgcg
G - C
G - C
A - T
G - C
C - G
G - C
G + T T A
T G T C C C A
A G A G | | | | | G
G G T C C C A G G G C
G | | | T T
C A A G G
C G A A CGTACCTGAAAGGGTACC
A - T
C - G
A - T
G + T
T - A
T A
T A
G C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |