Sequence ID | >SRA1032010 |
Genome ID | SRR035087.530095 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001808) |
Species | |
Start position on genome | 174 |
End posion on genome | 261 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
aaagcacccc |
tRNA gene sequence |
GGAGAGGTGGCAGAGTGGTTGAATGTGGCGGTCTCGAAAACCGTTGTGCGCGCAAGTGCA |
Downstream region at tRNA end position |
acaaacaaag |
Secondary structure (Cloverleaf model) | >SRA1032010 Ser CGA c GCag acaaacaaag G - C G - C A - T G - C A - T G - C G - C T A T C T C C C A T G A G | | | | | G G G A C G G A G G G C G | | + T T T A T G T T G A G TGTGCGCGCAAGTGCACC G + T C - G G - C G - C T - A C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |