Sequence ID | >SRA1032138 |
Genome ID | SRR035087.560450 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001808) |
Species | |
Start position on genome | 366 |
End posion on genome | 281 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
catagtttcc |
tRNA gene sequence |
GGAGGGATGGCCGAGAGGTCGAAGGCGGCGGTCTTGAAAACCGTTAACCGAAAGGTTCGC |
Downstream region at tRNA end position |
gaaaaggaaa |
Secondary structure (Cloverleaf model) | >SRA1032138 Ser TGA c GCCA gaaaaggaaa G - C G - C A - T G - C G - C G - C A - T T A T C G T C C A A G A G | | + | | G G G C C G G C G G G C G | | | T T T A G G C C G A G TAACCGAAAGGTTC G + T C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |