Sequence ID | >SRA1032143 |
Genome ID | SRR035087.562481 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001808) |
Species | |
Start position on genome | 119 |
End posion on genome | 46 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
tcgatgatac |
tRNA gene sequence |
GCTCCAGTAGCTTAACTGGATAGAGCAAGGCACTCCTAACGCCTAGGTTGGGGGTTCGAG |
Downstream region at tRNA end position |
tttgaggaaa |
Secondary structure (Cloverleaf model) | >SRA1032143 Arg CCT c Atat tttgaggaaa G - C C - G T - A C - G C - G A - T G - C T G T C T C C C A C A A A | + | | | G T T T C G G G G G G C G + | | | T T G G A G C A T A A AGGTT A - T G - C G - C C - G A C C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |