Sequence ID | >SRA1032344 |
Genome ID | SRR035087.609679 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001808) |
Species | |
Start position on genome | 254 |
End posion on genome | 180 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
acattacacT |
tRNA gene sequence |
CGGGGGATCGTCTAATGGTAGGACACCAGGTTTTGATCCTGGCAGCGGGGGTTCGAATCC |
Downstream region at tRNA end position |
aagaaacata |
Secondary structure (Cloverleaf model) | >SRA1032344 Gln TTG T AACA aagaaacata C - G G - C G - C G - C G - C G + T A G T A T T C C C C A A A C + | | | | G T T C T G G G G G G C G + | | | T T G G G A C T A A CAGC C - G C - G A - T G - C G - C T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |