Sequence ID | >SRA1032448 |
Genome ID | SRR035088.12114 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001809) |
Species | |
Start position on genome | 261 |
End posion on genome | 336 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
tagcttggct |
tRNA gene sequence |
GCCAGCGTAGCTCAGATGGCAGAGCAACTGATTTGTAATCAGTGGGTCGGGGGTTCGATT |
Downstream region at tRNA end position |
ctgtaggatn |
Secondary structure (Cloverleaf model) | >SRA1032448 Thr TGT t TCCA ctgtaggatn G - C C - G C - G A - T G - C C - G G - C T T T T T C C C A A G A A + + | | | G T C T C G G G G G G C G | | | | T T G G A G C C A A GGGTC A - T C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |