| Sequence ID | >SRA1032467 |
| Genome ID | SRR035088.18464 |
| Phylum/Class | 454 Sequencing (SRP001809) |
| Species | |
| Start position on genome | 169 |
| End posion on genome | 93 |
| Amino Acid | Met |
| Anticodon | CAT |
| Upstream region at tRNA start position |
ttttttcgat |
| tRNA gene sequence |
GGCGGCGTAGCTCAGTCGGTTAGAGCATCGGAATCATAATCCGAGTGTCCGGGGTTCGAG |
| Downstream region at tRNA end position |
tttgcgccag |
| Secondary structure (Cloverleaf model) | >SRA1032467 Met CAT
t ACCA tttgcgccag
G + T
G - C
C - G
G - C
G - C
C - G
G - C T G
T G T C C C A
T G A A | + | | | G
C C T C G C G G G G C
G | | | | T T
G G A G C
T T A A GTGTC
T - A
C - G
G - C
G - C
A - T
A A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |