Sequence ID | >SRA1032535 |
Genome ID | SRR035088.41066 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001809) |
Species | |
Start position on genome | 50 |
End posion on genome | 126 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
aattttgtaT |
tRNA gene sequence |
GCCTCGGTAGCTCAGCCTGGATAGAGCATTAGCCTTCTAAGCTAGGGGTCGCAGGTTCGA |
Downstream region at tRNA end position |
atctgcgcag |
Secondary structure (Cloverleaf model) | >SRA1032535 Arg TCT T ATtt atctgcgcag G - C C - G C - G T + G C - G G - C G - C T A T T G T C C A C C G A A + | | | | G T C T C G G C A G G C G | | | | T T G G A G C A T A A GGGTC T + G T - A A - T G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |