Sequence ID | >SRA1032691 |
Genome ID | SRR035088.80046 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001809) |
Species | |
Start position on genome | 307 |
End posion on genome | 214 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
taactagaat |
tRNA gene sequence |
GGAGGGGTGGCTGAGCGGTTGAAAGCAGTCGCCTGCTAAGCGATTGTCCTGGCTAAAACT |
Downstream region at tRNA end position |
tttttaacct |
Secondary structure (Cloverleaf model) | >SRA1032691 Ser GCT t GCCA tttttaacct G - C G - C A - T G - C G - C G - C G - C T A T G A C C C A C G A G | | | | | A G G T C G C T G G G C G | | | T T T A A G C T G A A TGTCCTGGCTAAAACTGGGACC G + T T - A C - G G - C C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |