Sequence ID | >SRA1032699 |
Genome ID | SRR035088.81569 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001809) |
Species | |
Start position on genome | 284 |
End posion on genome | 360 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
ttttttcgtt |
tRNA gene sequence |
GGGCCGTTAGCTCAGTTTGGTAGAGCAGCGGACTTTTAATCCGTTGGTCGCGAGTTCGAT |
Downstream region at tRNA end position |
aacaatatca |
Secondary structure (Cloverleaf model) | >SRA1032699 Lys TTT t ACCA aacaatatca G - C G - C G - C C - G C - G G - C T - A C T T C G C T C A T G A A | | | | | G T C T C G G C G A G C T | | | | T T G G A G C G T A A TGGTC G + T C - G G - C G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |