Sequence ID | >SRA1032766 |
Genome ID | SRR035088.98513 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001809) |
Species | |
Start position on genome | 170 |
End posion on genome | 97 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
tttaaacagc |
tRNA gene sequence |
TGGGGGATCGTATAGCGGCAATACGCAAGACTCTGACTCTTGTTACCCAGGTTCGAATCC |
Downstream region at tRNA end position |
aattctggtc |
Secondary structure (Cloverleaf model) | >SRA1032766 Gln CTG c GCCA aattctggtc T - A G - C G - C G - C G - C G - C A - T T A T G G T C C A G A C | | | | | G C T A T G C C A G G C G | | | | T T G A T A C C A G TTAC C - G A - T A - T G - C A - T C C T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |