Sequence ID | >SRA1032811 |
Genome ID | SRR035088.107783 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001809) |
Species | |
Start position on genome | 73 |
End posion on genome | -1 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
gtagttacat |
tRNA gene sequence |
GCACCCGTAGCTCAGCTGGATAGAGCACCAGGCTTCGAACCTGGGTGTCGCCCGTTCGAA |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >SRA1032811 Arg TCG t NNnn nnnnnnnnnn G + T C - G A - T C - G C - G C - G G - C T A T C G G G C A C G A A | | | | | G T C T C G G C C C G C G | | | | T T G G A G C A T A A GTGTC C - G C - G A - T G - C G - C C A T A T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |