Sequence ID | >SRA1032819 |
Genome ID | SRR035088.108381 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001809) |
Species | |
Start position on genome | 27 |
End posion on genome | 102 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
atcatatttc |
tRNA gene sequence |
GGGGGTGTAGCTCAGTTGGCAGAGCAGCTGACTCTTAATCAGCGGGTCTAGGGTTCAAAT |
Downstream region at tRNA end position |
tttttgagca |
Secondary structure (Cloverleaf model) | >SRA1032819 Lys CTT c ACCA tttttgagca G + T G - C G - C G - C G - C T - A G - C T A T A T C C C A T G A A | | | | | A T C T C G T A G G G C G | | | | T T G G A G C C A A GGGTC G - C C - G T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |