Sequence ID | >SRA1032821 |
Genome ID | SRR035088.108635 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001809) |
Species | |
Start position on genome | 106 |
End posion on genome | 30 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
tacaaaaagt |
tRNA gene sequence |
CGGGACGTGGCTCAGTCTGGTAGAGCACAGCGTTCGGGACGCTGGGGTCGCTGGTTCAAA |
Downstream region at tRNA end position |
cctgctattc |
Secondary structure (Cloverleaf model) | >SRA1032821 Pro CGG t ACCA cctgctattc C - G G - C G - C G - C A - T C - G G - C T A T T G A C C A T G A G + | | | | A C C T C G G C T G G C T | | | | T T G G A G C G T A A GGGTC C - G A - T G - C C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |