| Sequence ID | >SRA1033010 |
| Genome ID | SRR035088.151199 |
| Phylum/Class | 454 Sequencing (SRP001809) |
| Species | |
| Start position on genome | 155 |
| End posion on genome | 82 |
| Amino Acid | Thr |
| Anticodon | GGT |
| Upstream region at tRNA start position |
gttttgtcag |
| tRNA gene sequence |
GCTGATGTAGCTCAGTCGGTAGAGCACTTCCTTGGTAAGGAAGAGGTCATCGGTTCAAGT |
| Downstream region at tRNA end position |
gtttttgggt |
| Secondary structure (Cloverleaf model) | >SRA1033010 Thr GGT
g TCag gtttttgggt
G - C
C - G
T - A
G - C
A - T
T - A
G - C T G
T T A G C C A
T G A A | | | | | A
C C T C G A T C G G C
G | | | | T T
G G A G C
T A A AGGTC
C - G
T - A
T - A
C - G
C - G
T A
T A
G G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |