Sequence ID | >SRA1033125 |
Genome ID | SRR035088.179554 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001809) |
Species | |
Start position on genome | 263 |
End posion on genome | 189 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
gggatcgcat |
tRNA gene sequence |
TCCGCGATAGCTCAATGGTAGAGCATGCGGCTGTTAACCGCAGGGTTGTAAGTTCGAGTC |
Downstream region at tRNA end position |
ggcaaaaagc |
Secondary structure (Cloverleaf model) | >SRA1033125 Asn GTT t GCCA ggcaaaaagc T - A C - G C - G G - C C - G G - C A - T T G T C A T T C A A A A | | | | | G T C T C G G T A A G C G | | | | T T G G A G C T A A GGGTT T - A G - C C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |