Sequence ID | >SRA1033189 |
Genome ID | SRR035088.192796 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001809) |
Species | |
Start position on genome | 176 |
End posion on genome | 250 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
ttaaataatt |
tRNA gene sequence |
GGCCCCATAGTTCAAGGGATAGAATAGAAGTTTCCTAAACTTTAGATCCAGGTTCGAGTC |
Downstream region at tRNA end position |
aaacttttta |
Secondary structure (Cloverleaf model) | >SRA1033189 Arg CCT t ACTA aaacttttta G + T G - C C - G C - G C - G C - G A - T T G T G G T C C A G A A A | | | | | G G C T T G C C A G G C G | | | + T T A G A A T T A A AGAT G + T A - T A - T G - C T - A T A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |