Sequence ID | >SRA1033209 |
Genome ID | SRR035088.196610 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001809) |
Species | |
Start position on genome | 116 |
End posion on genome | 45 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
aaatctttta |
tRNA gene sequence |
GGCCACGTCGCCAAGTGGTAAGGCAAAAGTCTGCAAAACTTTCATCATGGGTTCGACTCC |
Downstream region at tRNA end position |
aattatcaat |
Secondary structure (Cloverleaf model) | >SRA1033209 Cys GCA a TCtg aattatcaat G - C G - C C - G C - G A - T C - G G - C T C T T A C C C A G A C | | | | | G T A C C G A T G G G C G | | | T T G A G G C T A A CATC A - T A - T A - T G - C T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |