Sequence ID | >SRA1033294 |
Genome ID | SRR035088.216822 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001809) |
Species | |
Start position on genome | 200 |
End posion on genome | 127 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
taggtttgct |
tRNA gene sequence |
GCCCCCATAGTTTAATGGCAAAACGTAGCAATGGTAATGCTGAGATACAAGTTCGATTCT |
Downstream region at tRNA end position |
tgagaaaaca |
Secondary structure (Cloverleaf model) | >SRA1033294 Thr GGT t ACCA tgagaaaaca G - C C - G C - G C - G C - G C - G A - T T T T T G C T C A A A A | | | | G T T T T G A C A A G C G | | | | T T G A A A C C A G AGAT T + G A - T G - C C - G A - T A A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |