Sequence ID | >SRA1033304 |
Genome ID | SRR035088.219940 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001809) |
Species | |
Start position on genome | 289 |
End posion on genome | 213 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
atcaattatt |
tRNA gene sequence |
GCCCCCGTAGCTCAGGTGGATAGAGCATCAGATTCCTAATCTGGGTGTCGTGCGTTCGAG |
Downstream region at tRNA end position |
aacaaactca |
Secondary structure (Cloverleaf model) | >SRA1033304 Arg CCT t ACCA aacaaactca G - C C - G C - G C - G C - G C - G G - C T G T C G C G C A G G A A | + | | | G T C T C G G T G C G C G | | | | T T G G A G C A T A A GTGTC T + G C - G A - T G - C A - T T A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |