| Sequence ID | >SRA1033433 |
| Genome ID | SRR035088.256733 |
| Phylum/Class | 454 Sequencing (SRP001809) |
| Species | |
| Start position on genome | 142 |
| End posion on genome | 227 |
| Amino Acid | Tyr |
| Anticodon | GTA |
| Upstream region at tRNA start position |
gaacgattgc |
| tRNA gene sequence |
GGGTAGGTAGCGAAGCGGTCAAACGCAACAGACTGTAAATCTGTCGACATATGTCTTCGG |
| Downstream region at tRNA end position |
tttttatttc |
| Secondary structure (Cloverleaf model) | >SRA1033433 Tyr GTA
c ACGA tttttatttc
G - C
G - C
G - C
T - A
A - T
G - C
G + T T A
T C C T C C A
C G A A | | | | | G
G A G C G G G A G G C
G | | | T T
T A C G C
C A A A CGACATATGTCTTC
A - T
C - G
A - T
G - C
A - T
C A
T A
G T A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |