Sequence ID | >SRA1033646 |
Genome ID | SRR035088.311354 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001809) |
Species | |
Start position on genome | 309 |
End posion on genome | 224 |
Amino Acid | Leu |
Anticodon | AAG |
Upstream region at tRNA start position |
attataacaT |
tRNA gene sequence |
GCAGATATGCCGGAGTGGTCAAACGGGTCAGGTTAAGGACCTGATAGCCTTGTGCTTACC |
Downstream region at tRNA end position |
attctcacct |
Secondary structure (Cloverleaf model) | >SRA1033646 Leu AAG T ATtg attctcacct G - C C - G A - T G - C A - T T + G A - T T A T G T T C C A T G A G | | + | | G G G G C C C A G G G C G | | | T T T A C G G C A A G TAGCCTTGTGCTTAC T - A C - G A - T G - C G - C T A T G A A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |